Molecular Basis of Inheritance PYQs Set 2 (PDF)

Set 2 of 5 · Questions 31-60 of 143

In the print window choose “Save as PDF”. The file prints without a web address or date line.

Mere Teacher · Previous Year Questions NEET Biology · Molecular Basis of Inheritance · Set 2 (Q31-60)
Scan or visit mereteacher.com for free PYQ practice, timed CBT tests, step-by-step solutions and BroBot AI. Answers and solutions are free with a sign-up.
31. $In the hexaploid wheat, the haploid (n) and basic (x) numbers of chromosomes are :-$ (1) $n = 7 and x = 21$ (2) $n = 21 and x = 21$ (3) $n = 21 and x = 14$ (4) $n = 21 and x = 7$ 32. $Which scientist experimentally proved that DNA is the sole genetic material in bacteriophage?$ (1) $Beadle and Tautum$ (2) $Messelson and Stahl$ (3) $Hershey and Chase$ (4) $Jacob and Monod$ 33. $Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?$ (1) $Genetic code is not ambiguous$ (2) $Genetic code is redundant$ (3) $Genetic code is nearly universal$ (4) $Genetic code is specific$ 34. $Molecular basis of organ differentiation depends on the modulation in transcription by:$ (1) $RNA polymerase$ (2) $Ribosome$ (3) $Transcription factor$ (4) $Anticodon$ 35. $Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follow 5'AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3?$ (1) $3' ATCGATCGATCGTCGATCG ATCGATCG 5,$ (2) $5 ' UAGCUAGCUAGCUAGCUA GCUAGC UAGC 3'$ (3) $3' UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5'$ (4) $5 ' ATCGATCGATCGATCGATCG ATCGATCG 3,$ 36. $E. Coli has only 4.6 \times 10^{6} base pairs and completes the process of replication within 18 minutes; then the average rate of polymerisation is approximately-$ (1) $3000 base pairs/second$ (2) $4000 base pairs/second$ (3) $1000 base pairs/second$ (4) $2000 base pairs/second$ 37. $A complex of ribosomes attached to a single strand of RNA is known as :-$ (1) $Polysome$ (2) $Polymer$ (3) $Polypeptide$ (4) $Okazaki fragment$ 38. $Choose the correct pair from the following:$ (1) $Polymerases - Break the DNA into fragments$ (2) $Nucleases - Separate the two strands of DNA$ (3) $Exonucleases - Make cuts at specific positions within DNA$ (4) $Ligases - Join the two DNA molecules$ 39. $If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?$ (1) $6.6 \times l 0^{9} bp$ (2) $3.3 \times 1 0^{6} bp$ (3) $6.6 \times 1 0^{6} bp$ (4) $3.3 \times l 0^{9} bp$ 40. $DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as :$ (1) $Satellite DNA$ (2) $Repetitive DNA$ (3) $Single nucleotides$ (4) $Polymorphic DNA$ 41. $What is the role of RNA polymerase III in the process of transcription in Eukaryotes?$ (1) $Transcription of only snRNAS$ (2) $Transcription of rRNAs (28 S, 18 S and 5.8S)$ (3) $Transcription of tRNA, 5 srRNA and snRNA$ (4) $Transcription of precursor of mRNA$ 42. $Ten E. coli with^{15} N - dsDNA are incubated in medium containing^{14} N nucleotide. After 60 minutes, how many E. coli cells will have DNA totally free from^{15} N ?$ (1) $80 cells$ (2) $20 cells$ (3) $40 cells$ (4) $60 cells$ 43. $What is the criterion for DNA fragments movement on agarose gel during gel electrophoresis?$ (1) $The smaller the fragment size, the farther it moves$ (2) $Positively charged fragments move to farther end$ (3) $Negatively charged fragments do not move$ (4) $The larger the fragment size, the farther it moves$ 44. $Ten E.coli cells with 15N - dsDNA are incubated in medium containing 14N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from 15N?$ (1) $40 cells$ (2) $60 cells$ (3) $80 cells$ (4) $20 cells$ 45. $Which is the basis of genetic mapping of human genome as well as DNA fingerprinting?$ (1) $Single nucleotide polymorphism$ (2) $Polymorphism in hnRNA sequence$ (3) $Polymorphism in RNA sequence$ (4) $Polymorphism in DNA sequence$ 46. $If Adenine makes 30 % of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?$ (1) $T : 20; G : 20; C : 30$ (2) $T : 30; G : 20; C : 20$ (3) $T : 20; G : 25; C : 25$ (4) $T : 20; G : 30; C : 20$ 47. $Antiparallel strands of a DNA molecule means that$ (1) $one strand turns anti-clockwise$ (2) $the phosphate groups of two DNA strands, at their ends, share the same position$ (3) $the phosphate groups at the start of two DNA strands are in opposite position (pole)$ (4) $one strand turns clockwise$ 48. $What is it that forms the basis of DNA Fingerprinting?$ (1) $The relative difference in the DNA occurrence in blood, skin and saliva.$ (2) $The relative amount of DNA in the ridges and grooves of the fingerprints.$ (3) $Satellite DNA occurring as highly repeated short DNA segments.$ (4) $The relative proportions of purines and pyrimidines in DNA.$ 49. $Commonly used vectors for human genome sequencing are :-$ (1) $T-DNA$ (2) $BAC and YAC$ (3) $Expression Vectors$ (4) $T/A Cloning Vectors$ 50. $Which of the following RNAs is not required for the synthesis of protein?$ (1) $tRNA$ (2) $rRNA$ (3) $siRNA$ (4) $mRNA$ 51. $PCR and Restriction Fragment Length Polymorphism are the methods for$ (1) $Study of enzymes$ (2) $Genetic transformation$ (3) $DNA sequencing$ (4) $Genetic fingerprinting$ 52. $DNA replication is semi-conservative in nature was experimentally proved in eukaryotes by :$ (1) $Macleod and McCarty$ (2) $Meselson and Stahl$ (3) $Talyor and his colleagues$ (4) $Hershey and Chase$ 53. $All of the following are part of an operon except :-$ (1) $an operator$ (2) $structural genes$ (3) $an enhancer$ (4) $a promoter$ 54. $Which of the following is not required for any of the techniques of DNA fingerprinting available at present?$ (1) $Polymerase chain reaction$ (2) $Zinc finger analysis$ (3) $Restriction enzymes$ (4) $DNA-DNA hybridization$ 55. $Which one of the following does not follow the central dogma of molecular biology?$ (1) $Chlamydomonas$ (2) $HIV$ (3) $Pea$ (4) $Mucor$ 56. $The final proof for DNA as the genetic material came from the experiments of :$ (1) $Hershey and Chase$ (2) $Avery, Mcleod and McCarty$ (3) $Hargobind Khorana$ (4) $Griffith$ 57. $DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the :-$ (1) $Alpha strand$ (2) $Antistrand$ (3) $Template strand$ (4) $Coding strand$ 58. $Which one of the following is wrongly matched?$ (1) $Transcription - Writing information from DNA to tRNA.$ (2) $Translation - Using information in mRNA to make protein.$ (3) $Repressor protein - Binds to operator to stop enzyme synthesis.$ (4) $Operon - Structural genes, operator and promoter.$ 59. $Which of the following statements is correct?$ (1) $Adenine pairs with thymine through one H -bond$ (2) $Adenine pairs with thymine through three H-bonds.$ (3) $Adenine does not pair with thymine.$ (4) $Adenine pairs with thymine through two H -bonds.$ 60. $Select the correct option: ((A): Direction RNA synthesis, (B): Direction of reading of the template DNA strand)$ (1) $5' ----- 3' 3' ------ 5'$ (2) $3' ----- 5' 5' ------ 3'$ (3) $5' ----- 3' 5' ------ 3'$ (4) $3' ----- 5' 3' ------ 5'$